Saturday, September 19, 2015

Week 2. Semester 3. PCR on positive controls and Analysis

Last Friday, September 11th, we set up a PCR on all our positive controls from the summer. Before we can collect new samples for DNA extraction and analysis, we must make sure our positive controls preserved well in the break and that we have no contamination. Once we collect samples we will compare the banding pattern of the amplified genes (16s and mip) against our positive controls, so it is imperative the controls are nice and clean and band appropriately. 
The PCR was prepared as follows:
PCR Tube: 20 μL MasterMix, 4 μL Forward/Reverse Primers,
1μL DNA*and 11 μL Sterile Water
ThermoCycler at an annealing temperature of 55 ͦC for 34 cycles.
Primers Used:  16s LEG-226: AAGATTAGCCTGCGTCCGAT (654 bp);
16s LEG-858: GTCAACTTATCGCGTTTGCT.
mip LpneuF: CCGATGCCACATCATTAGC (150 bp);

mip LpneuR: CCAATTGAGCGCCACTCATAG.

Banding pattern expected for the two amplified genes (16s in center of gel and mip in right).
 Picture courtesy of the Spring 2015 Legionella team.

Thursday, September 10, 2015

Week 1. Semester 3. Here we go again!!

This semester I will not be working in the Palo Verde project anymore, although I plan to continue working on the fungal exoenzyme isolation part of it on the side. Over the summer I had the opportunity to join Dr. Cotter's project on Legionella, so I will continue to work with her. We perform sample collections, DNA extractions, PCR amplifications, and analyze banding with electrophoresed agar gels and SyberGreen under UV light. For this semester, the plan is to take our findings one step further and confirm our results with genetic sequencing! The project data will be reported back to join more data from a bigger project to hopefully better understand the genus and how we become affected by its presence in water systems. This week the team will be meeting Friday, so check back next week for an update.
Electron micrograph of Legionella pneumophila bacteria
*Photo courtesy of CDC.gov
(http://www.cdc.gov/legionella/index.html)

Thursday, April 30, 2015

Week 15. Semester 2. Happy hour!

This week I retrieved my fungal cultures from the agitator and attempted to isolate the exoenzymes for use in DNA extraction later. The broth was centrifuged for 30 min at 5000 rpm and then filtered with a .25 micrometer paper in a vaccum. Only two of the broths filtered successfully and the other two plugged the smaller .25micro filter and a larger .45 micrometer filter as well, so they have not been filtered.
Additionally, another DNA extraction protocol was attempted and gave very promising results! In a nut shell, the protocol uses a 2.5% SDS lysis buffer and a one step 1:1 Phenol-Chloroform extraction (Lopez et all. 2013). This week has also been spent preparing my poster for the Estrella Mountain Student Conference.



 Vaccum Filtration for centrifuged media.
Top lanes are from new protocol ad bottom from previously used one. 


Lopez M, Gonzalez-Mendoza D, Grimaldo-Juarez O. 2013. Fast protocol for extraction of DNA from Prosopis spp leaves (plant adapted to arid environment) without liquid nitrogen. Genetics and molecular research [Online];[cited 03/04/2015]. 12.3 (4090-4094)Available from: http://www.funpecrp.com.br/gmr/year2013/vol12-3/pdf/gmr2488.pdf

Thursday, April 23, 2015

Week 14. Semester 2. Finally started fungus broth culture!

This week was spent working with fungi. I am a bit side tracked right now since I have put all DNA extractions on hold perhaps until next semester. I have concluded I will need to assay the cellulase solution we purchased from Sigma before I continue attempting extractions. I have tried different pHs and Temps but nothing seems to be successful, so I will take a step back and determine those experimentally since Sigma has very little information available in the company's website about that.
In the mid time I focused my attention on isolating enzymes from the different fungi I isolated from infected Palo Verde trees, with Matt's and Amanda's collaboration. I started the broths to grow the fungi and hopefully get lots of exoenzymes secreted by them. I have four 250 mL flasks with Wheat Bran, Corn Steep, Starch and CaCl2 and Urea in water. Everything was autoclaved and is incubating at room temp and 150rpm. Tomorrow I will feed them a lactose solution to accelerate growth.
One of the fungus is particularly interesting and I will continue to work to identify it. I will not go into much detail about what I have on it so far because I would like to spend more time figuring out if what I have found is actually accurate. LOL. But here are a few pictures. 

 Same fungus grown in different media. Isn't it beautiful?!
 Broths in incubator/agitator
 After being exposed a few times I decided I will start inoculating fungal stuff in hood. Just as an extra precaution. I eat a lot of sugar and don't want my fungi to find out hehe
Collected additional specimen of decaying leaves.

Wednesday, April 15, 2015

Week 13. Semester 2. Still no DNA but plenty of fungus!!

This week I attempted another DNA extraction with the protocol under development to be added to Protocol 17 (DeSalle 2002). The following was done:
1. Prepared citrate buffer and diluted to 50mM (Adney 1996).
2. Added 50microL Sigma Cellulase from aspergillus solution (1000U/g)
3. Used +/- .450 g of leaft tissue and the same from blossoms in simultaneous runs.
4. One set of samples was ground with mortar and pestle with buffer until paste was formed. The other half was added to buffer and shook until immersed in citrate buffer/enzyme solution in bottom of tube.
5. Incubated at 30C for 24 hours.
6. Centrifuged at 12,000rpm for 5 min.
7. Transferred supernatant to new tubes and added 500 microL of lysis buffer (3:1 4% SDS to 5% Sarkosyl).
8 Inverted to mix.
9. Incubated 5 min.
Proceeded with Protocol 17.

The DNA in solution was electrophoresed in 1% agar gels for 30 min at 100V and then viewed under UV light. The picture below shows no visible DNA. The bottom bands are from control from a previous extraction.

I also added some pictures of my fungal isolations.




References
     Adney B and Baker J. 1996. Measurements of cellulase activities: Laboratory analytical procedure. Golden (CO): National Renewable Laboratory; p. 2.
 
     DeSalle R, Giribet G, Wheeler W. 2002. Protocol 17. In: Techniques in molecular systematics and evolution [Internet]. Springer science and business media. p. 276-278.

Friday, April 10, 2015

Week 12. Semester 2. Some progress and FUNGUS!!

This week I reattempted a modified version of my protocol utilizing cellulase for breakage of the plant cell wall. The first try was not successful at all due to critical errors during execution and failure to interpret information resulting in an inadequate protocol, using a buffer I failed to dilute probably denaturing the cellulase complex immediately. This week, although not perfect, I finally feel I have made some progress.
The Enzyme incubation period was 24hrs. and I ran both a Grind and No Grind DNA extractions. Another variable was the use of Palo Verde blossoms in place of the leaflets to compare the yields and purity of DNA.
The protocol ran smoothly and I plan on running a gel next Monday to see results. However I can already predict based on the size of the DNA pellet that the samples that were ground in the mortar and pestle has a significant higher amount of DNA. This is great and may prove the enzyme digestion to be a good addition to the protocol. However, my goal is to eliminate the need for grinding altogether, so may be next time I will leave them a day longer. Or I may grind after the cellulase incubation period instead of before?
For next week, I also plant to finally start my fungal culture broths to isolate exoenzymes from them. I have successfully isolated four species from the plates on the pictures below, so we will see. Also Matt brought me samples from a Palo infected with some fungus!!! So I will isolate that as well and go from there hoping it will brake it down. By the way thank you Bethany!! for sharing your beautiful pink plates with me!!!
As we approach the end of the semester, I am feeling very overwhelmed with everything I am involved in at school, my classes and my family. It's hard to find time to sleep and the last couple of weeks were specially difficult since I felt I was not progressing in my project. However, talks with different scholars and with Matt and Josh have lifted my spirits and I feel re-energized and ready to wrap up the semester! I look forward to next semester, when I plan on having additional time to spend in my project!



Friday, April 3, 2015

Week 11. Semester 2. Research

The research was intense this week. I spent most of the week finding different buffers for the cellulase complex incubation. I learned I should have diluted the buffer I used in my previous extraction even further, this may have caused serious damage to the structure of the enzyme and rendered it useless from the beginning.

As we come closer to the end of the semester and I feel I haven't advanced much, I had moments of a lot of frustration and defeat. However, with the support and advice from other scholars and Matt and Josh, I felt re-energized toward the end of the week and decided to clear my mind a bit by spending some time working in identifying Olivia's bacteria (remember the fish Cel dissected a few weeks ago?). That was fun and helped me take a step back to look at my project with a new light and getting some other things in motion.

I inoculated a couple of plates with leaflets from a Palo Verde tree that seem to be decaying, hopefully I will get some fungus to grow and isolate exoenzymes from! Also I found fungus growth in an apple I bought at the store and I started a plate with that as well. It looked very similar to the pictures I found of Aspergillus, so I am hopeful.

Matt spent sometime with me going over running PCRs and then we realized I can't really run one next week until Thursday, but that should give me time to prepare for an extraction utilizing the modified protocol with a revised enzyme step and to start growing the fungi in the wheat germ, corn steep and malt broth!

Although I am not sure what I would report in my research paper and I am feeling a bit stuck. I am positive for things to come. Please refer to the pics below for fungi plates and for Olivia's investigation.

Palo Verde decaying. Hopefully fungus!

 Stick from apple with fungal growth (hopefully Palo Verde)

Some of Olivia's plates 

Isolation of bacteria in real life is nos as easy as I thought. 
I had more than one bacteria in Gram stain. Some Gram + and some -